circad | circRNAs associated with diseases

circRNA_0001073
Gene	ACVR2A	Organism	Human
Genome Locus	chr2:148653869-148657467:+	Build	hg19
Disease	Acne	ICD-10	Acne (L70)
DBLink	Link to database	PMID	29573483
Experimental Method
Sample Type	Skin Tissues	Comparison	lesional skin and adjacent non-lesional skin in patients with severe acne
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CACAAGATGGCCTACCCTCC Reverse CCATAACACGGTTCAACACCA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Liang, J, Wu, X, Sun, S, Chen, P, Liang, X, Wang, J, Ruan, J, Zhang, S, Zhang, X (2018). Circular RNA expression profile analysis of severe acne by RNA-Seq and bioinformatics. J Eur Acad Dermatol Venereol, 32, 11:1986-1992.